 |
|
Gene Expression Profile for Schizophrenia
Discrete Neuron Transcription Patterns in the Entorhinal Cortex
Scott E. Hemby, PhD;
Stephen D. Ginsberg, PhD;
Brian Brunk, PhD;
Steven E. Arnold, MD;
John Q. Trojanowski, MD, PhD;
James H. Eberwine, PhD
Arch Gen Psychiatry. 2002;59:631-640.
ABSTRACT
| |
Background Several lines of evidence indicate the altered function of the temporal
lobe, including the hippocampus and entorhinal cortex (EC), is associated
with schizophrenia. We used single-cell gene expression technologies to assess
coordinate changes in the expression of multiple genes, including neuronal
signaling and synaptic-related markers in EC layer II stellate neurons.
Methods We used a single-neuron microdissection technique coupled with linear
antisense RNA amplification and high density/candidate gene arrays to assess
coordinate changes in gene expression. The expression and relative abundance
of more than 18 000 messenger RNAs were assessed from EC layer II stellate
neurons from postmortem samples of schizophrenic and age-matched control brains.
Results of this initial screen were used to perform a more specific secondary
messenger RNA screen for each subject.
Results Data disclosed marked differences in expression of various G-protein–coupled
receptor-signaling transcripts, glutamate receptor subunits, synaptic proteins,
and other transcripts. Results of secondary screening showed significant decreases
in levels of G-protein subunit i 1, glutamate receptor 3, N-methyl-D-aspartate receptor 1, synaptophysin, and sensory nerve action
potentials 23 and 25 in the stellate neurons of schizophrenic patients. We
observed down-regulation of phospholemman (a phosphoprotein associated with
anion channel formation) messenger RNA and protein levels in layer II/III
stellate neurons in the population with schizophrenia.
Conclusions These results provide a preliminary expression profile of schizophrenia
in defined neuronal populations. Understanding the coordinated involvement
of multiple genes in human disease provides insight into the molecular basis
of the disease and offers new targets for pharmacotherapeutic intervention.
INTRODUCTION
SCHIZOPHRENIA IS a chronic, debilitating psychiatric illness affecting
approximately 1% of the general population. Clinical manifestations appear
during late adolescence to early adulthood. Characteristic features of schizophrenia
include a mixture of positive (distortions of inferential thought, perception,
language/communication, and behavioral monitoring) and negative (blunted affect,
alogia, and avolition) symptoms.1 The temporal
lobe, including the hippocampus, subiculum, and entorhinal cortex (EC), is
a primary brain region associated with schizophrenia. The EC is integral to
the function of the hippocampus, regulating the interaction of the hippocampus
with other brain regions. Disruption of neuronal functioning in this region
could affect information processing between the hippocampus and various cortical
areas. Dysregulation of temporal lobe function is associated with symptoms
that are similar to those found in individuals diagnosed as having schizophrenia.
For example, results of functional neuroimaging studies and neuropsychological
assessment of patients with schizophrenia report significant deficits in temporal
lobe function.2 Results of most structural
imaging studies in schizophrenia indicate a slight but significant reduction
in hippocampal volume,3-11
although other studies failed to observe these differences.12-14
A relative paucity of neurodegeneration, cell death, or gliosis is observed
in temporal lobe structures in schizophrenic brains.15-16
Although several abnormalities have been identified in the brains of
schizophrenic patients, alterations in neuronal organization and connectivity
in the temporal lobe represent a subtle neuropathologic feature of the disease.17 Several studies have reported decreased abundance
of synaptic protein messenger RNAs (mRNAs) and protein levels in schizophrenic
patients,18-24
indicating decreased synaptic density in this region and other possible alterations
in synaptic circuitry. In addition, catecholaminergic and glutamatergic signaling
abnormalities have been reported in the temporal lobe of schizophrenic patients,
suggesting alterations in the structure and connectivity of this region.25-27
Within the temporal lobe, EC layer II stellate neurons exhibit alterations,
including aberrant cytoarchitectural arrangement,28-30
smaller neuron size with normal neuron density,31
and decreased expression of the microtubule-associated protein 2.32 The EC layer II stellate neurons constitute an integral
component of the conduit through which information flows to the hippocampus,
which helps to regulate cortical-hippocampal-subcortical interactions.33 Disruption of the functional integrity of these neurons
may contribute to the aberrant behaviors associated with schizophrenia. The
strategic location of EC layer II stellate neurons and the previously identified
biological correlates in these neurons make them an excellent candidate for
probing disease-related differences in gene expression associated with schizophrenia.
Although several studies have provided insight into the roles of particular
genes, assessments have been limited to 1 or a few transcripts; however, the
multigenic nature of schizophrenia is probably due to the coordinate dysregulation
of several genes.34 Recently, Mirnics et al35 used complementary DNA (cDNA) microarray technology
to assess alterations in the expression of multiple genes in the prefrontal
cortex. Tissue samples were obtained from postmortem brains of schizophrenic
patients and age-matched control subjects. Regional assessments of gene expression
create an informative mosaic of expression level changes. Identifying specific
molecular correlates of schizophrenia has been complicated by several factors,
including clinical heterogeneity, cellular heterogeneity of cortical and subcortical
regions, and the difficulty in assessing multiple genes in discrete neuronal
populations. Methods of single-cell gene expression combined with cDNA microarray
technology can overcome some of the anatomical and molecular limitations by
assessing multiple transcripts in target neuronal populations. In the present
study, we report coordinate changes in the relative expression levels of more
than 18 000 genes in EC layer II stellate neurons from schizophrenic
patients and age-matched, nonpsychiatric control subjects using high-density
cDNA microarrays.
SUBJECTS AND METHODS
SUBJECTS
Brains from 8 patients who underwent long-term hospitalization for schizophrenia
and 9 age-matched neurologically normal controls were used. Postmortem brain
tissue from schizophrenic patients was obtained from the established brain
collection of the Mental Health Clinical Research Center on Schizophrenia
at the University of Pennsylvania, Philadelphia (Table 1). Control tissue was obtained via the Center for Neurodegenerative
Disease Research at the University of Pennsylvania. Controls had no history
of neurological or major psychiatric illness. We performed gross and microscopic
diagnostic neuropathologic examinations, which included examination of multiple
cortical and subcortical regions, in all cases, and no neuropathologic abnormalities
relevant to mental status were found. Schizophrenic subjects were elderly,
"poor-outcome" patients who were participants in clinicopathological studies
at the University of Pennsylvania School of Medicine in collaboration with
8 state hospitals in eastern and central Pennsylvania. All patients were prospectively
accrued, underwent clinical interviews and assessments, and were diagnosed
according to DSM-IV criteria1
by research psychiatrists of the Mental Health Clinical Research Center.36 In general, clinical features included prominent
negative symptoms, relatively mild positive symptoms, moderate to severe cognitive
dysfunction, and impairments in basic self-care activities that warranted
the long-term hospitalization of these patients. Antipsychotic treatment was
calculated as mean daily chlorpromazine equivalents from dose intervals ranging
from no greater than 72 hours, 1 month, and 1 year before death.
|
|
|
|
Table 1. Case Information*
|
|
|
IMMUNOCYTOCHEMISTRY
Tissue blocks, which included the middle portion of the EC, were dissected
from the temporal lobe at autopsy, fixed in a solution of 70% ethanol/150mM
sodium chloride, embedded in paraffin, and cut in 6-mm sections as described
previously.37 A section from each individual
was stained with acridine orange to verify the presence of nucleic acids in
the tissue.38 To identify individual neurons
for subsequent single-cell analysis, we performed immunocytochemistry for
the sections using a monoclonal antibody to nonphosphorylated neurofilament
(RmdO20).39 The antibody was labeled by means
of the avidin-biotin method (ABC Vectastain; Vector Laboratories, Burlingame,
Calif) and visualized by means of 3,3'-diamino benzidine.
SINGLE-CELL GENE EXPRESSION
After immunolabeling, an oligo(dT)-T7 primer/promoter
(AAACGACGGCCAGTGAATTGTAATACGACTCACTATA
GGCGC[T]24)
was hybridized to poly A+ mRNA overnight in a solution consisting
of 50% formamide/5x silver sulfadiazine and chlorhexidine (SSC) at 25°C.
Complimentary DNA was synthesized directly on the tissue sections (in situ
transcription) using avian myeloblastosis virus reverse transcriptase (0.5
U/µL) (Seikagaku America, Falmouth, Mass) in Tris buffer containing
6mM magnesium chloride, 120mM potassium chloride, 7mM dithiothreitol, 250µM
each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine
triphosphate, and thymidine triphosphate, and 0.12 U/µL of RNAsin.40 Sections were incubated at 37°C for 90 minutes.
Next, sections were washed twice in 2x SSC, 25°C for 5 minutes,
and stored at 4°C in 0.5x SSC up to 72 hours. After in situ transcription,
layer II stellate neurons were dissected using a micropipette attached to
a micromanipulator under a high-power objective field (original magnification
x40). Contents were collected in the pipette and emptied into 1.5-mL
microcentrifuge tubes for second-strand cDNA synthesis and subsequent antisense
RNA (aRNA) amplification. The amplification and reamplification procedures
are described in detail elsewhere.41-42
Samples were pooled immediately before second-round amplification. We incorporated
phosphorus 33-labeled cytidine triphosphate in the pooled sample probes destined
for hybridization of human gene discovery arrays (GDA; Genome Systems, Inc,
St Louis, Mo). The RNA samples were pooled for each subject and labeled with
phosphorus 32 cytidine triphosphate for candidate array hybridization. Under
optimal conditions, the first round of aRNA amplification results in an approximately
1000-fold yield and an approximately 106-fold yield after 2 rounds.
The aRNA procedure is a linear amplification process with minimal change in
the relative abundance of the mRNA population in the native state of the neuron.
Messenger RNA can be reliably amplified from small amounts of fixed tissue,
including individual neurons and neuronal processes.37, 41-43
For initial screening of the GDAs (>18 000 genes), aRNA from 6
neurons from each of 4 schizophrenic patients and 4 controls were pooled (eg,
24 neurons per condition for each array) before the second round of amplification.
Tissue from the schizophrenic patients was selected on the basis that none
had been treated with antipsychotic medication for at least 1 year before
death.
CONSTRUCTION OF CANDIDATE ARRAYS
Candidate arrays were prepared on nylon membranes containing, but not
limited to, dopamine receptors (eg, D1, D2, D4, D5, and DAT), G-protein subunits (i1, i2, s, z, q, o,  ,  1,
and 2), transcription factors (CREB, CRE2, CREM, junB, and juD
c-fos), glutamate receptor mRNAs (AMPA [GluR1-4], kainite [GluR5-7], and N-methyl-D-aspartate receptor 1 [NMDA R1]), and synaptic
proteins (-synuclein, synaptophysin 1 and 2, synaptobrevin, synaptobrevin
2, synaptogyrin 1a and 3, synaptic vesicle–associated protein [SNAP]
23 and 25, postsynaptic density 95, and synaptotagmin VII). Inserts were amplified
in 96-well plates using polymerase chain reaction analysis with M13 forward
and reverse primers under the following conditions: 95°C for 5 minutes
(1 cycle); 95°C for 30 seconds, 52°C for 45 seconds, and 72°C
for 2 minutes (40 cycles of this combination); and 72°C for 10 minutes
(1 cycle). After polymerase chain reaction analysis, aliquots underwent electrophoresis
on a 1% agarose gel (1x Tris-borate–EDTA pH 8.0 and 0.05% ethidium
bromide) at 5 V/cm, and the polymerase chain reaction band size was verified.
Gel images were captured by means of a digital camera and archived on a computer.
We spotted 250 ng of each amplified insert on a net nylon transfer membrane
(HyBond XL; Amersham Pharmacia Biotech, Minneapolis, Minn) using a 96-well
dot-blot apparatus (Minifold I; Schleicher & Schuell, Inc, Baltimore,
Md). The DNA was crosslinked to the membrane by means of UV radiation.
GDA AND CANDIDATE ARRAY HYBRIDIZATION
Arrays were hybridized for 24 hours at 44°C in a rotisserie hybridization
oven (Hybaid, Boston, Mass) with the following solution: 50% formamide, 5x
SSC, 5x Denhardt solution, 0.1% sodium dodecyl sulfate (SDS), 200 ng
of sheared salmon sperm, and 1.0mM sodium pyrophosphate. After hybridization,
membranes were washed sequentially with solutions consisting of 2x SSC/0.1%
SDS, 0.5x SSC/0.1% SDS, and 0.1x SSC/0.1% SDS for 20 minutes each
at 44°C. We detected labeled hybridized products using phosphoimager cassettes,
and we analyzed hybridization signal intensities using ImageQuant software
(Amersham Pharmacia/Molecular Dynamics, Menlo Park, Calif).
DATA ANALYSIS
The specific signal (minus background) of probe bound to each clone
is expressed as a ratio of the total hybridization intensity of the array,
thereby minimizing variations due to differences in the specific activity
of the probe and the absolute quantity of probe present.43
Differential expression of greater than 2-fold is accepted as above background
and relevant for further examination. Two-fold changes are considered a conservative
limit. Data from the candidate gene arrays were analyzed by t test, and the null hypothesis was rejected when P<.05.
RELATIONAL DATABASE
Data were imported into the RNA Abundance Database, an Oracle relational
database developed at the University of Pennsylvania. The RNA Abundance Database
is designed to capture information on RNA abundance assays for any type of
high-throughput gene expression experiment, including microarrays, macroarrays,
and serial analysis of gene expression tags. For each experiment, hybridization
signal intensity for each data point was expressed as a percentage of the
total intensity on the array. This enabled comparison of data generated under
different conditions and across experimental platforms. To identify genes
by functional role or chromosomal location, queries were performed against
the database of transcribed sequences (DoTS),44
a component of the Genomics Unified Schema relational database also developed
at the University of Pennsylvania and implemented in Oracle. The DoTS contains
known and putative transcripts from human and mouse tissues. Each transcript
has a consensus sequence assembled by computational analysis of the expressed
sequence tag (EST) and known mRNA sequences available in the public databases.
These DoTS transcripts were then annotated to assign such things as predicted
cellular roles, GO functions, and chromosomal locations.44
The spots in the array experiments can be linked to DoTS transcripts through
their respective EST sequences, allowing the assignment of cellular roles
of 13 510 and chromosomal location to 11 591 clones. Data sets were
selected by means of SQL queries joining the DoTS and RNA Abundance Database,
and scattergrams were generated using SigmaPlot software (SPSS Science, Chicago,
Ill).
RESULTS
DEMOGRAPHIC DATA
No significant difference was seen between the schizophrenic and control
groups in age (t15 = -1.14; P = .27), postmortem interval (t14 = 0.68; P = .51), or brain weight (t14 = -0.45; P
= .66), indicating these factors do not contribute to the observed changes
in differentially expressed genes. The schizophrenic group included 5 women
and 3 men with an average ± SEM age of 83 ± 9.3 years, whereas
the age of disease onset was 23.4 ± 3.4 years. The age-matched controls
(average ± SEM age, 77.7 ± 12.2 years) consisted of 5 women
and 4 men.
IMMUNOCYTOCHEMISTRY AND RNA RECOVERY
Examination of tissue sections after immunolabeling with RmdO20 disclosed
a distinct laminar pattern of immunoreactivity that was confined to the somatodendritic
region of neurons in layers II/III and V of the EC (Figure 1A-B). No distinct differences in the intensity or pattern
were apparent between the groups. Immunostaining was used to delineate layer
II stellate neurons for microdissection (Figure 1C-D). As in previous studies, no apparent difference was
seen in mRNA recovery between the groups.45
|
|
|
|
Figure 1. Immunoreactivity of a monoclonal
antibody to nonphosphorylated neurofilament (RmdO20) in the entorhinal cortex
(EC). Distribution and staining of medium-weight neurofilament immunoreactive
stellate neurons from control brain tissue in layer II of the EC under low
(A; scale bar, 50 µm) and high-power (B; scale bar, 10 µm) magnification
are seen. The arrow in panel A indicates the area of high-power magnification
shown in panel B. Section immunolabeled with RmdO20 with a representative
stellate neuron (C; scale bar, 25 µm) and after microdissection of the
indicated neuron (D; scale bar, 25 µm).
|
|
|
GENE EXPRESSION
The GDA format contained 18 240 genes, of which 2574 (14%) were
up-regulated more than 2-fold in the schizophrenic group and 1565 (9%) were
down-regulated. In addition, we examined a subgroup of transcripts that encode
proteins (13 510 mRNAs) of known function and are designated as all cell roles in the Institute for Genomic Research database.
Changes in gene expression were assessed by the degree of differential expression
in specific functional families encoding all cell roles, receptors (292 clones),
intracellular transducers (169 clones, including G proteins and second-messenger
systems), and extracellular matrix proteins (199 clones, including synaptic
proteins). The subsets were selected because of the key role members of each
of these families play in cellular functioning, not necessarily because of
their significance in schizophrenia. For convenience, differences in mRNA
levels for these categories are shown in Figure 2. The complete expression profiles generated in this study
are available in Excel format via e-mail (available at: eberwine{at}pharm.med.upenn.edu).
|
|
|
|
Figure 2. Comparison of gene expression
changes in the entorhinal cortex (EC) layer II stellate neurons in schizophrenic
brain for all cell roles (A), receptors (B), intracellular transducers (C),
and extracellular matrix proteins (D). Normalized expression of values in
age-matched controls and schizophrenic samples are plotted. Red line indicates
no change; blue lines, 2-fold up- or down-regulation; and black lines, 5-fold
up- or down-regulation.
|
|
|
RECEPTORS
The absence of dopamine receptor subtypes on the GDA arrays necessitated
inclusion of these clones of the custom-designed candidate arrays. No significant
difference was seen in mRNA abundance for D1, D2, D4, or D5 receptor subunits between the schizophrenic and
control groups (Figure 3A). Analysis
showed an up-regulation in serotonin receptor mRNA (+3.0-fold). The 2-adrenergic receptor mRNA was down-regulated 2.1-fold, a finding consistent
with the reduced 2-adrenergic receptor binding in the limbic
system of the schizophrenic brain.46 Secondary
screening of G-protein subunits that couple to monoamine receptors disclosed
a significant decrease in Gi1 subunit mRNA (t15 = 2.37; P = .03) and a significant increase
in G2 subunit mRNA (t15 = -2431; P = .03) levels in schizophrenic patients (Figure 3).
|
|
|
|
Figure 3. Comparisons of gene expression
changes between schizophrenic patients and control subjects for high-abundance
(A) and low-abundance (B) messages from reverse Northern blot analysis. Messenger
RNA expression values correspond to hybridization intensity for individual
transcripts divided by the total blot hybridization intensity, with the result
multiplied by 100. Bars represent mean ± SEM. The signal intensity
for each clone was normalized to the intensity of the blot. Asterisk indicates P<.05.
|
|
|
Several groups have reported alterations in -aminobutyric acid
and glutamate receptor protein and mRNA subunits in the schizophrenic brain.26-27,47-55
Consistent with these findings, we found a 4.2-fold increase in -aminobutyric
acid A1 subunit mRNA in schizophrenic patients. No significant differences
were detected in NMDA R2A, GluR1, GluR2, or GluR6 on the GDA arrays, and none
were detected for GluR1, GluR4, and GluR5 on the custom-designed arrays. However,
GluR3 was found to be significantly down-regulated on the GDA arrays (-2.2
fold) and confirmed using the custom-designed arrays (t15 = 2.18; P = .045). In addition,
NMDA R1 was significantly down-regulated in the schizophrenic group (t15 = 2.55; P = .02; Figure 4B) using the custom arrays.
|
|
|
|
Figure 4. Magnified portions of human gene
discovery microarray images after hybridization with control (A) and schizophrenic
(B) samples. Red arrows indicate doublets representing sensory nerve action
potential (SNAP) 25. In the control samples, labeled antisense RNA hybridized
to both complementary DNAs corresponding to SNAP 25 with moderate intensity.
In contrast, hybridization intensity was less intense in the schizophrenic
samples.
|
|
|
Cholinergic dysfunction has also been implicated in schizophrenia, including
decreased nicotinic receptor binding in the hippocampus56
and demonstration of a dinucleotide polymorphism at chromosome 15q13-14, the
site of the 7 subunit of the nicotinic receptor.57
Extending these reports, we found a 2.7-fold increase in expression of the 7
subunit mRNA in EC stellate neurons in our schizophrenic population.
GENES ASSOCIATED WITH SYNAPTIC PROTEINS
Several synaptic protein mRNAs were differentially regulated between
the schizophrenic and control groups, including down-regulation in schizophrenia
of -adaptin (-5.5-fold), synaptic vesicle amine transporter (-3.5-fold),
synaptotagmin I (-3.1-fold), synaptotagmin IV (-2.5-fold), and
SNAP 25 (-4.4-fold). An example of the differential hybridization intensity
for SNAP 25 on a GDA filter is provided in Figure 4. In addition, syntaxin mRNA was up-regulated (+4.4-fold)
in schizophrenic patients. Assessment of several synaptic protein mRNAs using
the candidate arrays showed significant decreases in synaptophysin (t15 = 2.22; P = .04),
SNAP 23 (t15 = 2.94; P = .01), and SNAP 25 (t15 = 2.09; P = .055) mRNA levels in schizophrenic patients (Figure 3B).
PHOSPHOLEMMAN EXPRESSION
Differential hybridization to the cDNAs encoding several ESTs was noted,
in addition to genes of known function. One of the most highly regulated ESTs
corresponded to phospholemman (PLM), a phosphoprotein involved in the formation
and/or regulation of a chloride anion channel. Expression levels of PLM mRNA
in single EC stellate neurons were lower in schizophrenic brains than in those
of matched controls (-4.5-fold). We were unable to perform secondary
screening on PLM mRNA abundance because of the lack of clone in the human
clone set (Emory Functional Genomics Facility, Atlanta, Ga). To determine
whether PLM protein was present in layer II/III stellate neurons, a polyclonal
antibody against PLM was used to stain sections adjacent to those used for
neuronal dissection and mRNA analysis. Immunoreactivity of PLM was detected
in 2 distinct cellular compartments in the human brains (Figure 5A-B), and a similar distribution was observed in rat brains
(data not shown). Diffuse cytoplasmic PLM immunoreactivity was detected within
the perikarya of EC stellate neurons and neocortical pyramidal cells, and
punctate PLM immunoreactivity was found in preterminal axons and terminal
fields throughout the hippocampal formation. Perforant pathway labeling was
particularly distinct (Figure 5C).
Semiquantitative assessment (by experimenters who were blind to the diagnosis)
of the 24 cases disclosed differences in PLM immunoreactivity within the perikarya
of layer II EC stellate neurons. Specifically, perikaryal PLM immunoreactivity
in EC stellate neurons was consistently less intense in the schizophrenic
brains than in the normal control brains (Figure 5A-B). No obvious differences were observed in the intense
axonal/terminal labeling of the perforant pathway axons that traverse the
subicular complex and terminate within the dentate gyrus.
|
|
|
|
Figure 5. Phospholemman (PLM) immunoreactivity
in the hippocampal formation. A polyclonal antibody against PLM protein was
used to stain sections adjacent to those used for neuronal dissection and
messenger RNA analysis. Distribution and staining intensity of PLM-immunoreactive
stellate cells in layer II of entorhinal cortex (EC) in a cognitively normal
control brain (A; scale bar, 50 µm). The high-power inset shows diffuse
cytoplasmic PLM immunoreactivity throughout the somatic domain of stellate
cells (scale bar, 25 µm). The PLM immunoreactivity is less intense within
the entorhinal cortex of a patient diagnosed as having schizophrenia (B; scale
bar, 50 µm). The inset depicts, at higher power, less intense PLM immunoreactivity
in the somatic compartment compared with the control brain (scale bar, 25
µm). The PLM-immunoreactive preterminal axons and terminals are observed
throughout the hippocampal formation, including the perforant path (C; scale
bar, 50 µm). Intense, punctate labeling of the perforant path is observed
traversing the subiculum, with some varicosities terminating in pericellular
basketlike arrangements. The inset depicts the area labeled by the asterisk
on the low-power image (scale bar, 10 µm).
|
|
|
GENES ASSOCIATED WITH REPORTED SCHIZOPHRENIA LINKAGE SITES
Approximately 25% of the genes in the public databases have been mapped
to chromosomal loci. We have used this information to examine the relative
abundances of various mRNAs whose genes map to presumed schizophrenia linkage
sites (Table 2). In this analysis,
it is clear that the abundances of most of these mRNAs remain relatively unchanged
within these regions, whereas some show dramatic differences. Individually,
these particular mRNAs are unlikely to be key causative factors of schizophrenia,
yet small changes in multiple genes spanning these different chromosomal sites
may indeed result in an altered cellular physiological presentation and contribute
to the schizophrenic phenotype. Since only a small fraction of the ESTs have
been mapped to chromosomal sites, we are continuing to map mRNAs whose abundance
is significantly different in schizophrenia. The present expression analysis
examines only the relative prevalence of mRNAs; we have not examined potential
genetic polymorphisms that may be associated with these specific genes and
result in the observed difference in mRNA abundance in schizophrenic patients
relative to controls.
|
|
|
|
Table 2. Number and Abundances of mRNAs Whose Abundance Is Altered
in Schizophrenia and Whose Genes Map to Presumed Schizophrenia Linkage Sites*
|
|
|
COMMENT
Results from the present study have identified several possible mechanisms
of neuronal dysfunction that may underlie aspects of schizophrenia. One such
mechanism involves vesicular proteins in synaptic function. Levels of mRNAs
encoding synaptic vesicle proteins (synpatophysin and synaptotagmin I and
IV) and synaptic plasma membrane proteins (SNAP 23 and SNAP 25) were found
to be significantly decreased in EC layer II stellate neurons of schizophrenic
patients, whereas another plasma membrane protein syntaxin was up-regulated
greater than 4-fold. The proteins encoded by these mRNAs serve different functions
at different functional steps in the synaptic vesicle cycle, and it is reasonable
to conclude that alterations in the levels of the proteins encoded by these
mRNAs may lead to decreased neurotransmitter release from the layer II stellate
neurons. For exocytosis to occur, a trimeric core complex must be formed consisting
of 2 synaptic plasma membrane proteins and 1 synaptic vesicle protein.58 Decreased levels of SNAP 25 may prevent the establishment
of the anchor complex for vesicular docking to the plasma membrane. Furthermore,
decreased levels of synaptotagmin I and IV, which bind the calcium2+ ion and possibly serve as a sensor for exocytosis,59
indicate another potential means of decreased neurotransmitter release. These
findings are paralleled by studies demonstrating decreased synaptic vesicle
protein mRNA and protein levels in the temporal cortex18, 20-24
and other brain regions.22, 35, 60-64
The altered expression of SNAP 25 and syntaxin are not likely due to long-term
antipsychotic treatment, since long-term haloperidol decanoate administration
in rodents does not affect SNAP 25 mRNA expression and decreases syntaxin
and synaptophysin mRNA expression.65-66
However, the observed decreases in synaptotagmin I and IV mRNA levels in schizophrenic
patients may be attributable in part to the treatment history, since long-term
haloperidol administration also decreases synaptotagmin mRNA levels,65 although extrapolations of these data to humans should
be made with caution.
Results of high-density array analysis indicate down-regulation of 2-adrenergic receptor mRNAs46 and up-regulation
of the -aminobutyric acid A152-55
subunit and serotonin receptor mRNA, findings that are consistent with those
of previous studies. No significant differences were observed for the dopamine
receptor subtype mRNAs in the present study. However, Gi1 and G2
subunit mRNA levels were significantly reduced and elevated, respectively,
in the schizophrenic population, a finding consistent with Gi immunoreactivity
in the temporal cortex of schizophrenic patients.67
Glutamatergic dysfunction is yet another possible mechanism underlying the
neuropathophysiology of schizophrenia, specifically, the gene and protein
expression of the ionotropic subtypes in human postmortem tissue.47-51
For example, previous studies have demonstrated decreased expression of GluR1
and GluR2 mRNAs in hippocampal subfields27
and NMDA R1 mRNA in the temporal cortex.68
Extending these findings, NMDA R1 and GluR3 were down-regulated in EC layer
II stellate neurons in the present study. Dysregulation in ionotropic glutamate
receptors may have profound downstream effects, including alterations in excitatory
neurotransmission and subsequent cognitive and behavioral sequelae believed
to be driven by glutamatergic circuitry.
In addition to genes known to be involved in synaptic function, array
analysis led to the identification of PLM mRNA in the EC layer II stellate
neurons. Phospholemman is a phosphoprotein involved in the formation and/or
regulation of a chloride anion channel69 enriched
in cardiac and skeletal muscle, although results of Northern blot analysis
have demonstrated moderate mRNA expression in total brain homogenates.70-71 Perikaryal PLM immunoreactivity in
EC stellate neurons was consistently less intense in the schizophrenic brains
than in the normal control brains. The observed EC staining pattern is not
selective to our brain collection population; it was replicated in EC tissue
sections from 2 schizophrenic patients obtained from the Stanley Foundation
Brain Bank, Bethesda, Md. Further studies are warranted to characterize the
neuroanatomical distribution of PLM, to delineate the functional role of this
protein in the brain, and to further assess the contribution of PLM down-regulation
in schizophrenia.
Chromosomal mapping of genes that are altered in schizophrenia may provide
insight into how the chromosomal abnormality is manifested in the symptomatology
of schizophrenia. These genes may map directly a chromosomal breakage, but
more likely are adjacent genes whose regulation is affected in schizophrenia.
Such regulatory differences may be associated with polymorphisms in the promoter
regions of these genes that, in turn, alter transcription rates leading to
changes in mRNA abundance. Individual mRNAs are unlikely to be singular causal
factors for schizophrenia. However, small changes in multiple genes spanning
these different chromosomal loci may result in an altered cellular physiology,
thus contributing to the schizophrenic phenotype.
A common confound in using human tissue for neuropathophysiological
examinations lies in the clinical diagnosis of the individual patient. In
the present study, the use of a prospective collection of brains from subjects
who underwent clinical assessment during life obviates this problem. Since
the pharmacological course of treatment for schizophrenia may influence gene
expression, initial screening of arrays used brain tissue from patients who
had not received antipsychotic medication for at least 1 year before death,
followed by secondary screening of all subjects in the sample population regardless
of medication history. The observed consistency in these hybridization patterns
is likely due to the long-term treatment histories of all subjects in the
study. Nevertheless, the influence of medication exposure on gene expression
cannot be discounted. The postmortem interval was similar to or less than
that of other studies and is unlikely to grossly influence the molecular analysis
presented herein.18-22,27, 35, 45, 66
Nonetheless, the utility of an expression profile specific for schizophrenia
can be envisioned. For example, differentially expressed transcripts could
serve as an additional postmortem diagnostic tool. Application of similar
technologies to generate peripheral markers may enable more rapid diagnosis
and pharmacological intervention tailored to the patient's specific symptoms.
In addition, confirmation of corresponding changes at the protein level may
provide novel targets for drug discovery and/or a refinement of existent pharmacotherapies.
In the future, disease-related transcripts might also be targets for gene
therapy interventions.
AUTHOR INFORMATION
Submitted for publication January 21, 2000; final revision received
September 26, 2001; accepted October 18, 2001.
This study was supported by the Walter Sonneborn Katz National Alliance
for Research on Schizophrenia and Depression (NARSAD) Young Investigator Award
(Great Neck, NY) and a National Alliance for Autism Research Award (Princeton,
NJ) (Dr Hemby), a NARSAD Distinguished Investigator Award (Dr Eberwine), grants
AG10124 and AG09215 from the National Institute on Aging (Bethesda, Md) (Dr
Trojanowski), and grants MH55199 (Dr Arnold) and MH43880 (Drs Trojanowski
and Arnold) from the National Institute of Mental Health (Bethesda).
The Functional Genomics Facility of the Emory University School of Medicine,
Atlanta, Ga, provided the cDNA clones for secondary screening, and the Stanley
Foundation, Bethesda, kindly provided schizophrenic and normal tissue sections
from brains in their brain bank. Larry Jones, PhD, kindly provided the phospholemman
antibody. The authors thank the staff of the Mental Health Clinical Research
Center on Schizophrenia and the Department of Pathology and Laboratory Medicine
of the University of Pennsylvania for their assistance in case accrual and
evaluation.
Corresponding author and reprints: James H. Eberwine, PhD, Department
of Pharmacology, University of Pennsylvania, 3620 Hamilton Walk, Philadelphia,
PA 19104.
From the Departments of Pharmacology and Psychiatry and Behavioral
Sciences, Yerkes Regional Primate Research Center, Neuroscience Division,
Emory University School of Medicine, Atlanta, Ga (Dr Hemby); the Dementia
Research Program, Department of Psychiatry, Nathan Kline Institute, New York
University School of Medicine, Orangeburg (Dr Ginsberg); and the Center for
Bioinformatics (Dr Brunk) and the Departments of Psychiatry (Drs Arnold and
Eberwine), Neurology (Drs Arnold and Eberwine), Pharmacology (Dr Eberwine),
and Pathology and Laboratory Medicine (Dr Trojanowski), University of Pennsylvania
School of Medicine, Philadelphia. Dr Hemby is a consultant for Solvay Pharmaceuticals,
Utrecht, the Netherlands. Dr Eberwine is on the Scientific Advisory Board
of Incyte Pharmaceuticals, Sunnyvale, Calif, which owns Genome Systems. Drs
Eberwine and Trojanowski are Founding Scientists, consultants and stockholders
for Layton BioScience, Inc, Sunnyvale, which has licensed the aRNA amplification
and in situ transcription methods.
REFERENCES
| |
1. American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, Fourth
Edition. Washington, DC: American Psychiatric Association; 1994.
2. Gur RE. Functional brain-imaging studies in schizophrenia. In: Psychopharmacology: The Fourth Generation of
Progress. 4th ed. New York, NY: Raven Press; 1995:1185-1192.
3. Bogerts B, Ashtari M, Degreef G, Alvir JM, Bilder RM, Lieberman JA. Reduced temporal limbic structure volumes on magnetic resonance images
in first episode schizophrenia. Psychiatry Res. 1990;35:1-13.
ISI
| PUBMED
4. Breier A, Buchanan RW, Elkashef A, Munson RC, Kirkpatrick B, Gellad F. Brain morphology and schizophrenia: a magnetic resonance imaging study
of limbic, prefrontal cortex, and caudate structures. Arch Gen Psychiatry. 1992;49:921-926.
FREE FULL TEXT
5. Shenton ME, Kikinis R, Jolesz FA, Pollak S, Lemay M, Wible C, Hokama H, Martin J, Metcalf D, Coloman M. Abnormalities of the left temporal lobe and thought disorder in schizophrenia:
a quantitative magnetic resonance imaging study. N Engl J Med. 1992;327:604-612.
ABSTRACT
6. Altshuler LL, Bartzokis G, Grieder T, Curran J, Jimenez T, Leight K, Wilkins J, Gerner R, Mintz J. An MRI study of temporal lobe structures in men with bipolar disorder
or schizophrenia. Biol Psychiatry. 2000;48:147-162.
FULL TEXT
|
ISI
| PUBMED
7. Suddath RL, Christison GW, Torrey EF, Casanova MF, Weinberger DR. Anatomical abnormalities in the brains of monozygotic twins discordant
for schizophrenia. N Engl J Med. 1990;322:789-794. [published correction appears in N Engl J Med. 1990;322:1616].
8. Becker T, Elmer K, Mechela B, Schneider F, Taubert S, Schroth G, Grodd W, Bartels M, Beckmann H. MRI findings in medial temporal lobe structures in schizophrenia. Eur Neuropsychopharmacol. 1990;1:83-86.
FULL TEXT
| PUBMED
9. Rossi A, Stratta P, Mancini F, Gallucci M, Mattei P, Core L, Di Michele V, Casacchia M. Magnetic resonance imaging findings of amygdala-anterior hippocampus
shrinkage in male patients with schizophrenia. Psychiatry Res. 1994;52:43-53.
FULL TEXT
|
ISI
| PUBMED
10. Gur RE, Turetsky BI, Cowell PE, Finkelman C, Maany V, Grossman RI, Arnold SE, Bilker WB, Gur RC. Temporolimbic volume reductions in schizophrenia. Arch Gen Psychiatry. 2000;57:769-775.
FREE FULL TEXT
11. Flaum M, Swayze II VW, O'Leary DS, Yuh W, Ehrhardt J, Arndt S, Andreasen N. Effects of diagnosis, laterality, and gender on brain morphology in
schizophrenia. Am J Psychiatry. 1995;152:704-714.
FREE FULL TEXT
12. Buchanan RW, Breier A, Kirkpatrick B, Elkashef A, Munson RC, Gellad F, Carpenter WT Jr. Structural abnormalities in deficit and nondeficit schizophrenia. Am J Psychiatry. 1993;150:59-65.
FREE FULL TEXT
13. Turetsky BT, Cowell PE, Gur RC, Grossman RI, Shtasel DL, Gur RE. Frontal and temporal lobe brain volumes in schizophrenia: relationship
to symptomatology and clinical subtype. Arch Gen Psychiatry. 1995;52:1061-1070.
FREE FULL TEXT
14. Hoff AL, Wieneke M, Faustman WO, Horon R, Sakuma M, Blankfeld H, Espinoza S, DeLisi LE. Sex differences in neuropsychological functioning of first-episode
and chronically ill schizophrenic patients. Am J Psychiatry. 1998;155:1437-1439.
FREE FULL TEXT
15. Falkai P, Honer WG, David S, Bogerts B, Majtenyi C, Bayer TA. No evidence for astrogliosis in brains of schizophrenic patients: a
post-mortem study. Neuropathol Appl Neurobiol. 1999;25:48-53.
ISI
| PUBMED
16. Arnold SE, Trojanowski JQ, Gur RE, Blackwell P, Han L, Choi C. Absence of neurodegeneration and neural injury in the cerebral cortex
in a sample of elderly patients with schizophrenia. Arch Gen Psychiatry. 1998;55:225-232.
FREE FULL TEXT
17. Trojanowski JQ, Arnold SE. In pursuit of the molecular neuropathology of schizophrenia. Arch Gen Psychiatry. 1995;52:274-276.
FREE FULL TEXT
18. Eastwood SL, Harrison PJ. Detection and quantification of hippocampal synaptophysin messenger
RNA in schizophrenia using autoclaved, formalin-fixed, paraffin wax–embedded
sections. Neuroscience. 1999;93:99-106.
FULL TEXT
|
ISI
| PUBMED
19. Eastwood SL, Harrison PJ. Hippocampal and cortical growth-associated protein-43 messenger RNA
in schizophrenia. Neuroscience. 1998;86:437-448.
FULL TEXT
|
ISI
| PUBMED
20. Eastwood SL, Harrison PJ. Decreased synaptophysin in the medial temporal lobe in schizophrenia
demonstrated using immunoautoradiography. Neuroscience. 1995;69:339-343.
FULL TEXT
|
ISI
| PUBMED
21. Eastwood SL, Burnet PW, Harrison PJ. Altered synaptophysin expression as a marker of synaptic pathology
in schizophrenia. Neuroscience. 1995;66:309-319.
FULL TEXT
|
ISI
| PUBMED
22. Thompson PM, Sower AC, Perrone-Bizzozero NI. Altered levels of the synaptosomal associated protein SNAP-25 in schizophrenia. Biol Psychiatry. 1998;43:239-243.
FULL TEXT
|
ISI
| PUBMED
23. Sokolov BP, Tcherepanov AA, Haroutunian V, Davis K. Levels of mRNAs encoding synaptic vesicle and synaptic plasma membrane
proteins in the temporal cortex of elderly schizophrenic patients. Biol Psychiatry. 2000;48:184-196.
FULL TEXT
|
ISI
| PUBMED
24. Young CE, Arima K, Xie J, Hu L, Beach T, Falkai P, Honer W. SNAP-25 deficit and hippocampal connectivity in schizophrenia. Cereb Cortex. 1998;8:261-268.
FREE FULL TEXT
25. Akil M, Lewis DA. The catecholaminergic innervation of the human entorhinal cortex: alterations
in schizophrenia [abstract]. Soc Neurosci Abstr. 1995;21:238.
26. Longson D, Deakin JF, Benes FM. Increased density of entorhinal glutamate-immunoreactive vertical fibers
in schizophrenia. J Neural Transm. 1996;103:503-507.
27. Eastwood SL, McDonald B, Burnet PW, Beckwith J, Kerwin R, Harrison P. Decreased expression of mRNAs encoding non-NMDA glutamate receptors
GluR1 and GluR2 in medial temporal lobe neurons in schizophrenia. Mol Brain Res. 1995;29:211-223.
PUBMED
28. Arnold SE, Han L-Y, Ruscheinsky DD. Further evidence of cytoarchitectural abnormalities of the entorhinal
cortex in schizophrenia using spatial point pattern analyses. Biol Psychiatry. 1997;42:639-647.
FULL TEXT
|
ISI
| PUBMED
29. Arnold SE, Hyman BT, Hoesen GWV, Damasio AR. Some cytoarchitectural abnormalities of the entorhinal cortex in schizophrenia. Arch Gen Psychiatry. 1991;48:625-632.
FREE FULL TEXT
30. Jakob H, Beckmann H. Prenatal developmental disturbances in the limbic allocortex in schizophrenics. J Neural Transm. 1986;65:303-326.
31. Arnold SE, Franz BR, Gur RC, Gur RE, Shapiro R, Moberg P, Trojanowski J. Smaller neuron size in schizophrenia in hippocampal subfields that
mediate cortical-hippocampal interactions. Am J Psychiatry. 1995;152:738-748.
FREE FULL TEXT
32. Arnold SE, Lee VMY, Gur RE, Trojanowski J. Abnormal expression of two microtubule-associated proteins (MAP2 and
MAP5) in specific subfields of the hippocampal formation in schizophrenia. Proc Natl Acad Sci U S A. 1991;88:10850-10854.
FREE FULL TEXT
33. Jones RSG. Entorhinal-hippocampal connections: a speculative view of their function. Trends Neurosci. 1993;16:58-64.
FULL TEXT
|
ISI
| PUBMED
34. Eberwine J, Crino P, Arnold S, et al. Molecular analysis of the single cell: importance in the study of psychiatric
disorders. In: Psychopharmacology: Fifth Generation of Progress [book on CD-ROM]. Philadelphia, Pa: Lippincott-Raven Publishers; 1998.
35. Mirnics K, Middelton FA, Marquez A, et al. Molecular characterization of schizophrenia viewed by microarray analysis
of gene expression in prefrontal cortex. Neuron. 2000;28:53-67.
FULL TEXT
|
ISI
| PUBMED
36. Arnold SE, Gur RE, Shapiro RM, Fisher K, Moberg P, Gibney M, Gur RC, Blackwell P, Trojanowski J. Prospective clinicopathologic studies of schizophrenia: accrual and
assessment of patients. Am J Psychiatry. 1995;152:731-737.
FREE FULL TEXT
37. Ginsberg SD, Crino PB, Hemby SE, Weingarten J, Lee U, Eberwine J, Trojanowski J. Predominance of neuronal mRNAs in individual Alzheimer's disease senile
plaques. Ann Neurol. 1999;45:174-181.
FULL TEXT
|
ISI
| PUBMED
38. Mikel UV, Becker RL Jr. A comparative study of quantitative stains for DNA in image cytometry. Anal Quant Cytol Histol. 1991;13:253-260.
ISI
| PUBMED
39. Lee VMY, Carden MJ, Schlaepfer WW, Trojanowski J. Monoclonal antibodies distinguish several differentially phosphorylated
states of the two largest rat neurofilament subunits (NF-H and NF-M) and demonstrate
their existence in the normal nervous system of adult rats. J Neurosci. 1987;7:3474-3488.
ABSTRACT
40. Tecott L, Barchas J, Eberwine J. In situ transcription: specific synthesis of cDNA in fixed tissue sections. Science. 1988;240:1661-1664.
FREE FULL TEXT
41. Van Gelder RN, von Zastrow ME, Yool A, Dement W, Barchas J, Eberwine J. Amplified RNA synthesized from limited quantities of heterogeneous
cDNA. Proc Natl Acad Sci U S A. 1990;87:1663-1667.
FREE FULL TEXT
42. Eberwine J, Yeh H, Miyashiro K, Cao Y, Nair S, Finnell R, Zettel M, Coleman P. Analysis of gene expression in single live neurons. Proc Natl Acad Sci U S A. 1992;89:3010-3014.
FREE FULL TEXT
43. Ginsberg SD, Hemby SE, Weintgarten JE, Lee V, Eberwine J, Trojanowski J. Expression profile of transcripts in Alzheimer's disease tangle bearing
CA1 neurons. Ann Neurol. 2000;48:77-87.
FULL TEXT
|
ISI
| PUBMED
44. DoTS program of Genomics Unified Schema. Allgenes.org Web site. Available at: http://www.allgenes.org. Accessed 2000.
45. Harrison PJ, Burnet PW, Falkai P, Bogerts B, Eastwood S. Gene expression and neuronal activity in schizophrenia: a study of
polyadenylated mRNA in the hippocampal formation and cerebral cortex. Schizophr Res. 1997;26:93-102.
FULL TEXT
|
ISI
| PUBMED
46. Joyce JN, Lexow N, Kim SJ, Artymyshyn R, Senzon S, Lawrence D, Cassanova M, Winokur A. Distribution of beta-adrenergic receptor subtypes in human post-mortem
brain: alterations in limbic regions of schizophrenics. Synapse. 1992;10:228-246.
FULL TEXT
|
ISI
| PUBMED
47. Gao XM, Sakai K, Roberts RC, Conley R, Dean B, Tamminga C. Ionotropic glutamate receptors and expression of N-methyl-D-aspartate receptor subunits in subregions of human hippocampus:
effects of schizophrenia. Am J Psychiatry. 2000;157:1141-1149.
FREE FULL TEXT
48. Healy DJ, Haroutunian V, Powchik P, Davidson M, Davis K, Watson S, Meador-Woodruff J. AMPA receptor binding and subunit mRNA expression in prefrontal cortex
and striatum of elderly schizophrenics. Neuropsychopharmacology. 1998;19:278-286.
FULL TEXT
|
ISI
| PUBMED
49. Noga JT, Hyde TM, Herman MM, Spurney C, Bigelow L, Weinberger D, Kleinman J. Glutamate receptors in the postmortem striatum of schizophrenic, suicide,
and control brains. Synapse. 1997;27:168-176.
FULL TEXT
|
ISI
| PUBMED
50. Sokolov BP. Expression of NMDAR1, GluR1, GluR7, and KA1 glutamate receptor mRNAs
is decreased in frontal cortex of "neuroleptic-free" schizophrenics: evidence
on reversible up-regulation by typical neuroleptics. J Neurochem. 1998;71:2454-2464.
ISI
| PUBMED
51. Meador-Woodruff JH, Healy DJ. Glutamate receptor expression in schizophrenic brain. Brain Res Brain Res Rev. 2000;31:288-294.
FULL TEXT
| PUBMED
52. Benes FM, Vincent SL, Marie A, Khan Y. Up-regulation of GABAA receptor binding on neurons of the prefrontal
cortex in schizophrenic subjects. Neuroscience. 1996;75:1021-1031.
FULL TEXT
|
ISI
| PUBMED
53. Benes FM, Khan Y, Vincent SL, Wickramasinghe R. Differences in the subregional and cellular distribution of GABAA receptor
binding in the hippocampal formation of schizophrenic brain. Synapse. 1996;22:338-349.
FULL TEXT
|
ISI
| PUBMED
54. Dean B, Hussain T, Hayes W, Scarr E, Kitsoulis S, Hill C, Opeskin K, Copolow D. Changes in serotonin2A and GABA(A) receptors in schizophrenia: studies
on the human dorsolateral prefrontal cortex. J Neurochem. 1999;72:1593-1599.
FULL TEXT
|
ISI
| PUBMED
55. Ohnuma T, Augood SJ, Arai H, McKenna P, Emson P. Measurement of GABAergic parameters in the prefrontal cortex in schizophrenia:
focus on GABA content, GABA(A) receptor alpha-1 subunit messenger RNA and
human GABA transporter-1 (HGAT-1) messenger RNA expression. Neuroscience. 1999;93:441-448.
FULL TEXT
|
ISI
| PUBMED
56. Freedman R, Hall M, Adler LE, Leonard S. Evidence in postmortem brain tissue for decreased numbers of hippocampal
nicotinic receptors in schizophrenia. Biol Psychiatry. 1995;38:22-33.
FULL TEXT
|
ISI
| PUBMED
57. Freedman R, Coon H, Myles-Worsley M, Orr-Urtreger A, Olincy A, Davis A, Polymeropoulos M, Holik J, Hopkins J, Hoff M, Rosenthal J, Waldo MC, Reimherr F, Wender P, Yaw J, Young DA, Breese CR, Adams C, Patterson D, Adler LE, Kruglyak L, Leonard S, Byerley W. Linkage of a neurophysiological deficit in schizophrenia to a chromosome
15 locus. Proc Natl Acad Sci U S A. 1997;94:587-592.
FREE FULL TEXT
58. Sudhof TC. The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature. 1995;375:645-653.
FULL TEXT
| PUBMED
59. Shao X, Li C, Fernandez I, Zhang X, Sudhof TC, Rizo J. Synaptotagmin-syntaxin interaction: the C2 domain as a Ca2+-dependent
electrostatic switch. Neuron. 1997;18:133-142.
FULL TEXT
|
ISI
| PUBMED
60. Gabriel SM, Haroutunian V, Powchik P, Honer WG, Davidson M, Davies P, Davis KL. Increased concentrations of presynaptic proteins in the cingulate cortex
of subjects with schizophrenia. Arch Gen Psychiatry. 1997;54:559-566.
FREE FULL TEXT
61. Karson CN, Mrak RE, Schluterman KO, Sturner WQ, Sheng JG, Griffin WS. Alterations in synaptic proteins and their encoding mRNAs in prefrontal
cortex in schizophrenia: a possible neurochemical basis for "hypofrontality." Mol Psychiatry. 1999;4:39-45.
FULL TEXT
|
ISI
| PUBMED
62. Perrone-Bizzozero NI, Sower AC, Bird ED, Benowitz LI, Ivins KJ, Neve RL. Levels of the growth-associated protein GAP-43 are selectively increased
in association cortices in schizophrenia. Proc Natl Acad Sci U S A. 1996;93:14182-14187.
FREE FULL TEXT
63. Glantz LA, Lewis DA. Reduction of synaptophysin immunoreactivity in the prefrontal cortex
of subjects with schizophrenia: regional and diagnostic specificity. Arch Gen Psychiatry. 1997;54:943-952.
FREE FULL TEXT
64. Honer WG, Falkai P, Young C, Hashimoto K, Hondo H, Hisatomi S, Motomura K, Uchimura H. Cingulate cortex synaptic terminal proteins and neural cell adhesion
molecule in schizophrenia. Neuroscience. 1997;78:99-110.
FULL TEXT
|
ISI
| PUBMED
65. Nakahara T, Nakamura K, Tsutsumi T, et al. Effect of chronic haloperidol treatment on synaptic protein mRNAs in
the rat brain. Mol Brain Res. 1998;61:238-242.
PUBMED
66. Eastwood SL, Heffernan J, Harrison PJ. Chronic haloperidol treatment differentially affects the expression
of synaptic and neuronal plasticity-associated genes. Mol Psychiatry. 1997;2:322-329.
FULL TEXT
|
ISI
| PUBMED
67. Yang CQ, Kitamura N, Nishino N, Shirakawa O, Nakai H. Isotype-specific G protein abnormalities in the left superior temporal
cortex and limbic structures of patients with chronic schizophrenia. Biol Psychiatry. 1998;43:12-19.
FULL TEXT
|
ISI
| PUBMED
68. Humphries C, Mortimer A, Hirsch S, de Belleroche N. NMDA receptor mRNA correlation with antemortem cognitive impairment
in schizophrenia. Neuroreport. 1996;7:2051-2055.
ISI
| PUBMED
69. Chen LS, Lo CF, Numann R, Cuddy M. Characterization of the human and rat phospholemman (PLM) cDNAs and
localization of the human PLM gene to chromosome 19q13.1. Genomics. 1997;41:435-443.
FULL TEXT
|
ISI
| PUBMED
70. Moorman JR, Ackerman SJ, Kowdley GC, Griffin MP, Mounsey JP, Chen Z, Cala SE, O'Brian JJ, Szabo G, Jones LR. Unitary anion currents through phospholemman channel molecules. Nature. 1995;377:737-740.
FULL TEXT
| PUBMED
71. Chen Z, Jones LR, O'Brian JJ, Moorman JR, Cala SE. Structural domains in phospholemman: a possible role for the carboxyl
terminus in channel inactivation. Circ Res. 1998;82:367-374.
FREE FULL TEXT
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati  Twitter
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
|
Gene Expression in the Etiology of Schizophrenia
Bray
Schizophr Bull 2008;34:412-418.
ABSTRACT
| FULL TEXT
FXYD1 is an MeCP2 target gene overexpressed in the brains of Rett syndrome patients and Mecp2-null mice
Deng et al.
Hum Mol Genet 2007;16:640-650.
ABSTRACT
| FULL TEXT
Gene Expression Profiling in Schizophrenia and Related Mental Disorders
Iwamoto and Kato
Neuroscientist 2006;12:349-361.
ABSTRACT
Region-specific reduction in entorhinal gamma oscillations and parvalbumin-immunoreactive neurons in animal models of psychiatric illness.
Cunningham et al.
J. Neurosci. 2006;26:2767-2776.
ABSTRACT
| FULL TEXT
Reduced Parahippocampal Connectivity Produces Schizophrenia-like Memory Deficits in Simulated Neural Circuits With Reduced Parahippocampal Connectivity
Talamini et al.
Arch Gen Psychiatry 2005;62:485-493.
ABSTRACT
| FULL TEXT
Importance of Input Perturbations and Stochastic Gene Expression in the Reverse Engineering of Genetic Regulatory Networks: Insights From an Identifiability Analysis of an In Silico Network
Zak et al.
Genome Res 2003;13:2396-2405.
ABSTRACT
| FULL TEXT
Discrete Cell Gene Profiling of Ventral Tegmental Dopamine Neurons after Acute and Chronic Cocaine Self-Administration
Backes and Hemby
J. Pharmacol. Exp. Ther. 2003;307:450-459.
ABSTRACT
| FULL TEXT
Epigenetic Downregulation of GABAergic Function in Schizophrenia: Potential for Pharmacological Intervention?
Costa et al.
Mol. Interv. 2003;3:220-229.
ABSTRACT
| FULL TEXT
Multiple Dysregulated Genes in Patients with Schizophrenia
JWatch Psychiatry 2002;2002:7-7.
FULL TEXT
|
